Deteksi Cepat Gen InvA pada Salmonella spp. Dengan Metode PCR
Article Sidebar
Main Article Content
Abstract
Salmonella spp. merupakan penyebab infeksi utama pada manusia melalui rute oral dengan cara mengkontaminasi makanan dan minuman. Penyakit yang disebabkan oleh Salmonella spp. disebut salmonellosis. Salmonella spp. memiliki gen invA yang menyebabkan patogen pada manusia. Deteksi gen InvA dapat dilakukan dengan metode PCR. Tujuan penelitian ini adalah untuk pengembangan metode deteksi cepat Gen InvA pada Salmonella spp. dengan metode PCR. Tahapan metode penelitian dimulai dari kultur Salmonella ATCC, Isolasi DNA Salmonella ATCC, Analisis Kuantitatif DNA Salmonella ATCC, Desain primer spesifik untuk deteksi gen InvA, Karakterisasi primer, Optimasi komponen PCR. Hasil isolasi DNA Salmonella ATCC yang didapat dengan konsentrasi DNA sebesar 4,5 ng/ul dengan kemurnian DNA 1,66. Primer PCR yang telah didesain untuk deteksi gen InvA terdiri dari satu pasang primer, yaitu InvA-F: 5’ TCGTCATTCCATTACCTACC 3’dan InvA-R: 5’ AAACGTTGAAAAACTGAGGA 3’ yang menghasilkan produk PCR gen InvA sepanjang 119 bp. Gen InvA dapat dideteksi dengan cepat menggunakan metode PCR yang telah dioptimasi komponen PCR.
Article Details
The authors retain the copyright and grant the journal the right of first publication simultaneously under the Creative Commons Attribution License. This license allows others to share the work with proper acknowledgment of authorship and initial publication in this journal. Authors are permitted and encouraged to deposit their articles in institutional repositories, on their personal websites, or in other online repositories after the article has been published in JSFK.
References
Jawetz, E., Melnick, J. L., Adelberg, E. A. Mikrobiologi Kedokteran, Jakarta: EGC; 2005.
Pham, O. H., & McSorley, S. J. Protective host immune responses to Salmonella infection. Future microbiology. 2015;10(1),101-110.
Jay, J. M., Loessner, M. J., Golden, D. A. Modern food microbiology. Food Science Text Series. New York: Springer; 2005.
Dzen, S. M., Roekistiningsih, S. S., Winarsih, S., Sumarno, I. S., Noorhamdani, A. S. Bakteriologi Medik. Malang: Bayumedia; 2003.
Prasetyo, R. V., Ismoedijanto, V. Metode Diagnostik Demam Tifoid pada Anak. Bagian Ilmu Kesehatan Anak FK Unair; 2009.
Olsen, S. J., Pruckler, J., Bibb, W., Thanh, N. T. M., Trinh, T. M., Minh, N. T., Chau, N. V. Evaluation of rapid diagnostic tests for typhoid fever. Journal of clinical microbiology. 2004;42(5):1885-1889.
Zeitoun, H., Kassem, M., Raafat, D., AbouShlieb, H., Fanaki, N. Microbiological testing of pharmaceuticals and cosmetics in Egypt. BMC microbiology. 2015;15(1):275.
He, X., Xu, X., Li, K., Liu, B., Yue, T. Identification of Salmonella enterica Typhimurium and variants using a novel multiplex PCR assay. Food control. 2016;65:152-159.
Horton, R. A., Card, R., Randall, L. P., & Teale, C. J. Differentiation of UK endemic strains of Salmonella enterica serovar Newport from epidemic North American strains by PCR detection of a truncated bapA chromosomal gene. Research in veterinary science. 2016;104:113-116.
Corporation, P. Wizard ® Genomic DNA Purification Kit Wizard ® Genomic DNA. Solutions. 2009; 1123–1126.
Sambrook, J., David W. Russell. Molecular Clonning : A Laboratory Manual. 3th ed. Sold Spring Harbor Laboratori Press Book 1&2; 2001.
Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., Madden, T. L. Primer-BLAST: a tool to design target-specific primers for polymerase chain reaction. BMC bioinformatics. 2012;13(1): 134.
Yuwono. Teori dan Aplikasi Polymerase Chain Reaction, Panduan Eksperimen PCR untuk Memecahkan Masalah Biologi Terkini, Yogyakarta: Andi; 2006.
Hoarau G, Coyer JA, Stam WT, Olsen JL. A fast and inexpensive DNA extraction/purification protocol for brown macroalgae. Molecular Ecology Notes. 2007;7:191–193.
Cheng YJ, Guo WW, Yi HL, Pang XM., Deng X. An efficient protocol for genomic DNA extraction from citrus species. Plant Molecular Biology Reporter. 2003;21:177a-177g.
Alves, J., Hirooka, E.Y., Oliveira, T.C.R.M. de. Development of a multiplex real-time PCR assay with an internal amplification control for the detection of Campylobacter spp. and Salmonella spp. in chicken meat.LWT Food Sci. Technol. 2016;72: 175 –181.
Grunenwald, H. Optimization of Polymerase Chain Reactions. Dalam Bartlett dan Stirling (Eds). Method in Molecular Biology: PCR Protocols Second Edition. Humana Press; 2007.
Jalali, M., Zaborowska, J., Jalali, M. The Polymerase Chain Reaction: PCR, qPCR, and RT-PCR. In Basic Science Methods for Clinical Researchers. 2016:1-18.
Haley, S. D., Miklas, P. N., Afanador,L., Kelly, J. D. Random Amplified Polymorphic DNA (RAPD) MarkerVariability Between and Within Gene Pools of Common Bean. J. Amer. Soc. Hort. Sci. 2004;199 (1):122-125.
Padmalatha, K., M.N.V. Prasad. Optimization of DNA Isolation and PCR Protocol for RAPD Analysis of Selected Medicinal and Aromatic Plants of Conservation Concern from Peninsular India. African Journal Biotechnology. 2006;5:230–234.
Harini, S.S., M. Leelombik, M.N.S. Kameshwari,, N. Sathyanarayana. Optimization of DNA Isolation and PCR-RAPD Methods for Molecular Analysis of Urginea indica Kunth. International Journal of Integrative Biology. 2008;2:138–144.