Desain Primer Gen 12S sRNA dari DNA Mitrokondria Babi (Sus scrofa) secara In Silico sebagai Kandidat Primer dalam Analisis Molekuler Kehalalan Produk

Taufik Muhammad Fakih, Salsabilla Wijaya, Sani Ega Priani

Abstrak


Beberapa produk seperti obat, makanan, dan kosmetika khususnya kolagen dapat berpotensi mengandung turunan babi sehingga diperlukan adanya analisis kehalalan. . Polymerase Chain Reaction (PCR) merupakan metode yang dapat digunakan untuk melakukan analisis sampel secara molekuler. Tujuan dari penelitian ini adalah mendesain kandidat primer dari gen 12S rRNA babi secara in silico. . Metode yang digunakan adalah penelusuran data gen 12S rRNA melalui situs National Center for Biotechnology Information (NCBI), kemudian sekuen gen 12S rRNA dianalisis menggunakan server web Integrated DNA Technologies (IDT) dan MFEprimer-3.1 untuk dilakukan pemilihan kandidat primer terbaik. Kandidat primer terpilih kemudian diidentifikasi menggunakan server web SnapGene Viewer untuk mengamati kemampuan penempelan kandidat primer pada sekuen target. Pada tahap terakhir dilakukan evaluasi kandidat primer menggunakan server web OligoAnalyzer™ Tool agar diperoleh pasangan kandidat primer terbaik yang memenuhi kriteria primer yang baik. Kandidat primer yang terbaik adalah primer forward rRNA-5 (5’ GTACTACTCGCAACTGCCTAAA 3’) dan primer reverse rRNA-6 (5’GCAAGGGTTGGTAAGGTCTATC 3’) karena memenuhi persyaratan primer ideal. . Dengan demikian, kandidat primer tersebut dapat digunakan untuk karakterisasi sampel secara in vitro menggunakan teknik PCR.


Kata Kunci


gen 12S rRNA; turunan babi; Polymerase Chain Reaction (PCR); kandidat primer; studi in silico

Teks Lengkap:

PDF

Referensi


. Widayat W, Winarni Agustini T, Suzery M, Ni’matullah Al-Baarri A, Rahmi Putri S. Real Time-Polymerase Chain Reaction (RT-PCR) sebagai Alat Deteksi DNA Babi dalam Beberapa Produk Non-Pangan. Indones J Halal. 2019;2(1):26. https://doi.org/10.14710/halal.v2i1.5361

. Zabidi AR, Fauzi FN, Abd Razak FN, Rosli D, Jamil MZM, Wan Ibrahim WK, et al. Screening porcine DNA in collagen cream cosmetic products. Food Res. 2019;4(February):151–6. https://doi.org/10.26656/fr.2017.4(S1).S05

. Khan N, Sarwar A, Tan BC. Determinants of purchase intention of halal cosmetic products among Generation Y consumers. J Islam Mark. 2020; https://doi.org/10.1108/JIMA-11-2019-0248

. Sionkowska A, Adamiak K, Musial K, Gadomska M. Collagen based materials in cosmetic applications: A review. Vol. 13, Materials. 2020. https://doi.org/10.3390/MA13194217

. Xhauflaire-Uhoda E, Fontaine K, Piérard GE. Kinetics of moisturizing and firming effects of cosmetic formulations. Int J Cosmet Sci. 2008;30(2). https://doi.org/10.1111/j.1468-2494.2008.00436.x

. Bukhari SNA, Roswandi NL, Waqas M, Habib H, Hussain F, Khan S, et al. Hyaluronic acid, a promising skin rejuvenating biomedicine: A review of recent updates and pre-clinical and clinical investigations on cosmetic and nutricosmetic effects. Vol. 120, International Journal of Biological Macromolecules. 2018. https://doi.org/10.1016/j.ijbiomac.2018.09.188

. Miljkovic S, Jeftic B, Sarac D, Matovic V, Slavkovic M, Koruga D. Influence of hyper-harmonized fullerene water complex on collagen quality and skin function. J Cosmet Dermatol. 2020;19(2). https://doi.org/10.1111/jocd.12999

. Extraction of acid and pepsin soluble collagen from selected Malaysian freshwater fish muscles: modified Lowry’s measurement method. J Agrobiotechnology. 2013;4(1).

. Kim YS, Yu HK, Lee BZ, Hong KW. Effect of DNA extraction methods on the detection of porcine ingredients in halal cosmetics using real-time PCR. Appl Biol Chem. 2018;61(5). https://doi.org/10.1007/s13765-018-0389-x

. Shabani H, Mehdizadeh M, Mousavi SM, Dezfouli EA, Solgi T, Khodaverdi M, et al. Halal authenticity of gelatin using species-specific PCR. Food Chem. 2015;184. https://doi.org/10.1016/j.foodchem.2015.02.140

. Hidayati H, Hasbullah H, Hasri S. Methods for Detection of Foods, Cosmetics, and Drugs Through A Mitochondrial DNA Analysis (An Overview of the Molecular and the Qur’anic Aspects). In 2020. https://doi.org/10.4108/eai.1-10-2019.2291746

. Nikzad J, Shahhosseini S, Tabarzad M, Nafissi-Varcheh N, Torshabi M. Simultaneous detection of bovine and porcine DNA in pharmaceutical gelatin capsules by duplex PCR assay for Halal authentication. DARU, J Pharm Sci. 2017;25(1). https://doi.org/10.1186/s40199-017-0171-3

. Hall Sedlak R, Jerome KR. The potential advantages of digital PCR for clinical virology diagnostics. Vol. 14, Expert Review of Molecular Diagnostics. 2014. https://doi.org/10.1586/14737159.2014.910456

. Kameswari S, Brundha MP, Ezhilarasan D. Advantages and disadvantages of RT- PCR in COVID 19. Eur J Mol Clin Med. 2020;7(1).

. Ma J, Wang YP, Ren S, Zhang Z, Lu S, Wang PW. Cloning flanking sequence by single-primer PCR in transgenic plants. Genet Mol Res. 2014;13(4). https://doi.org/10.4238/2014.October.20.16

. Ahlawat S, Sharma R, Maitra A, Roy M, Tantia MS. Designing, optimization and validation of tetra-primer ARMS PCR protocol for genotyping mutations in caprine Fec genes. Meta Gene. 2014;2. https://doi.org/10.1016/j.mgene.2014.05.004

. Medrano RFV, De Oliveira CA. Guidelines for the tetra-primer ARMS-PCR technique development. Mol Biotechnol. 2014;56(7). https://doi.org/10.1007/s12033-014-9734-4

. Vandevanter DR, Warrener P, Bennett L, Schultz ER, Coulter S, Garber RL, et al. Detection and analysis of diverse herpesviral species by consensus primer PCR. J Clin Microbiol. 1996;34(7). https://doi.org/10.1128/jcm.34.7.1666-1671.1996

. Padhi BK, Pelletier G, Shwed PS. A bioinformatics workflow for the evaluation of RT-qPCR primer specificity: Application for the assessment of gene expression data reliability in toxicological studies. Regul Toxicol Pharmacol. 2020;111. https://doi.org/10.1016/j.yrtph.2020.104575

. Pitaloka DAE, Ramadhan DSF, Arfan, Chaidir L, Fakih TM. Docking-based virtual screening and molecular dynamics simulations of quercetin analogs as enoyl-acyl carrier protein reductase (Inha) inhibitors of mycobacterium tuberculosis. Sci Pharm. 2021;89(2). https://doi.org/10.3390/scipharm89020020

. Cahyadi M, Wibowo T, Pramono A, Abdurrahman ZH. A novel multiplex-pcr assay to detect three non-halal meats contained in meatball using mitochondrial 12s rrna gene. Food Sci Anim Resour. 2020;40(4). https://doi.org/10.5851/kosfa.2020.e40

. Galal-Khallaf A. Multiplex PCR and 12S rRNA gene sequencing for detection of meat adulteration: A case study in the Egyptian markets. Gene. 2021;764. https://doi.org/10.1016/j.gene.2020.145062

. Hassab El-Nabi S, Hussein D, Khallafa A. Molecular detection of food fraud targeting mitochondrial 12S rRNA gene sequencing. J Biosci Appl Res. 2021;0(0). https://doi.org/10.21608/jbaar.2021.167091

. Kang SSN, Lee HG, Kim H. Development and comparison of a porcine gelatin detection system targeting mitochondrial markers for Halal authentication. LWT. 2018;97. https://doi.org/10.1016/j.lwt.2018.07.062

. Acland A, Agarwala R, Barrett T, Beck J, Benson DA, Bollin C, et al. Database resources of the National Center for Biotechnology Information. Nucleic Acids Res. 2013;41(D1). https://doi.org/10.1093/nar/gks1189

. Hu D, Hu S, Wan W, Xu M, Du R, Zhao W, et al. Effective optimization of antibody affinity by phage display integrated with high-throughput DNA synthesis and sequencing technologies. PLoS One. 2015;10(6). https://doi.org/10.1371/journal.pone.0129125

. Wang K, Li H, Xu Y, Shao Q, Yi J, Wang R, et al. MFEprimer-3.0: Quality control for PCR primers. Nucleic Acids Res. 2019;47(W1). https://doi.org/10.1093/nar/gkz351

. WANG X, ZHANG H, ZHAO X, ZHAI Z, JU Z, PENG J, et al. Complete genome sequence of mcr-1-harboring Escherichia coli discovered from Mink. Minerva Biotecnol. 2020;32(4). https://doi.org/10.23736/S1120-4826.20.02649-X

. Wang KW, Barker K, Benner S, Betancourt T, Hall CK. Development of a simple coarse-grained DNA model for analysis of oligonucleotide complex formation. Mol Simul. 2018;44(12). https://doi.org/10.1080/08927022.2018.1469753

. Li Y, Zhang J, Wei W, Wang Z, Prinz M, Hou Y. A strategy for co-analysis of microRNAs and DNA. Forensic Sci Int Genet. 2014;12. https://doi.org/10.1016/j.fsigen.2014.04.011

. Yasmon A, Fatmawati NND, Ibrahim F, Bela B. A second generation of RT-PCR assay for detection of human immunodeficiency virus type 1 (HIV-1) infection. Med J Indones. 2010;19(3). https://doi.org/10.13181/mji.v19i3.397

. Razei A, Sorouri R, Mousavi SL, Nazarian S, Amani J, Aghamollaei H. Presenting a rapid method for detection of Bacillus cereus, Listeria monocytogenes and Campylobacter jejuni in food samples. Iran J Basic Med Sci. 2017;20(9). https://doi.org/10.22038/IJBMS.2017.9275

. Giménez MJ, Pistón F, Martín A, Atienza SG. Application of real-time PCR on the development of molecular markers and to evaluate critical aspects for olive oil authentication. Food Chem. 2010;118(2). https://doi.org/10.1016/j.foodchem.2009.05.012

. Zaid T, Ereqat S, Nasereddin A, Al-Jawabreh A, Abdelkader A, Abdeen Z. Molecular characterization of Anaplasma and Ehrlichia in ixodid ticks and reservoir hosts from Palestine: a pilot survey. Vet Med Sci. 2019;5(2). https://doi.org/10.1002/vms3.150

. Li LY, Li Q, Yu YH, Zhong M, Yang L, Wu QH, et al. A primer design strategy for PCR amplification of GC-rich DNA sequences. Clin Biochem. 2011;44(8–9). https://doi.org/10.1016/j.clinbiochem.2011.02.001

. Motta FC, Born PS, Resende PC, Brown D, Siqueira MM. An inexpensive and accurate reverse transcription-PCR–melting temperature analysis assay for real-time influenza virus B lineage discrimination. J Clin Microbiol. 2019;57(12). https://doi.org/10.1128/JCM.00602-19

. Chen H, Takei F, Koay ESC, Nakatani K, Chu JJH. A novel DANP-coupled hairpin RT-PCR for rapid detection of Chikungunya virus. J Mol Diagnostics. 2013;15(2). https://doi.org/10.1016/j.jmoldx.2012.10.004

. Yang Z, Le JT, Hutter D, Bradley KM, Overton BR, McLendon C, et al. Eliminating primer dimers and improving SNP detection using self-avoiding molecular recognition systems. Biol Methods Protoc. 2020;5(1). https://doi.org/10.1093/biomethods/bpaa004




DOI: https://doi.org/10.25077/jsfk.8.3.316-322.2021

Article Metrics

Abstract view : 336 times
PDF view/download : 241 times



Jurnal Sains Farmasi & Klinis (J Sains Farm Klin) | p-ISSN: 2407-7062 | e-ISSN: 2442-5435

Diterbitkan oleh Fakultas Farmasi Universitas Andalas bekerjasama dengan Ikatan Apoteker Indonesia - Daerah Sumatera Barat 

      

 JSFK is licensed under Creative Commons Attribution-ShareAlike 4.0 International License.